CCall_contig26073_v2
| Name | CCall_contig26073_v2 |
|---|---|
| Accession | ID4036059 |
| Sequence | GGAAAATAAAGTAAAATAACAAATATGTAAAAGTTTAACAATCTAGTTAA |
| Length | 147 |
| Type | contig |
| Organism | Chinese Chestnut |
[-] Collapse All
References
| Dababase | Accession |
|---|---|
| GFF_source | SeqManPro |
Loading...
Alignment Viewer
ESTs in this contig
| Type | Feature | Position |
|---|---|---|
| EST | CCCanker_096570_2337_0251 | 0-128 |
| EST | CCCanker_088135_1303_1014 | 33-147 |
Loading...

Blast Hits to Contigs V2 CC454
Analysis Date: 11-17-2009 (Blast:CCall_contigs_v2_vs_CC454_contigs_v2)
Best 10 Hits Shown
Note: Click a description for more details.
Best 10 Hits Shown
Note: Click a description for more details.
| Match Name | E value | Identity | ||
|---|---|---|---|---|
CC454_contig1853_v2 | 6.19884e-19 | 78.79% | ||
CC454_contig1853_v2 | ||||
HSP 1 Score: 69.7986 bits (146), Expect = 6.19884e-19 Query: 47 LRRLQKL*XLICVRQRLCFFYPNC*NVDNVKIW 145 HSP 2 Score: 36.3494 bits (73), Expect = 6.19884e-19 Query: 4 K*SKITNM*KFNNLVKKASEI 66 HSP 3 Score: 67.0494 bits (140), Expect = 4.02815e-18 Query: 63 TKS*HCQHFNN*DRRSKAFVLHK*VFTI 146 HSP 4 Score: 36.3494 bits (73), Expect = 4.02815e-18 Query: 6 SEAFLTRLLNFYIFVILLY 62 HSP 5 Score: 64.3001 bits (134), Expect = 1.2412e-16 Query: 62 PNLNIVNILTIRIEEAKPLSYTNKXSQF 145 HSP 6 Score: 34.0583 bits (68), Expect = 1.2412e-16 Query: 7 F*SLLN*IVKLLHICYFTL 63 HSP 7 Score: 62.9255 bits (131), Expect = 3.8069e-15 Query: 60 RNCEXLFV*DKGFASSILIVKMLTMLRFG 146 HSP 8 Score: 30.3927 bits (60), Expect = 3.8069e-15 Query: 17 *QICKSLTI*LRRLQ 61 HSP 9 Score: 61.0927 bits (127), Expect = 6.51612e-11 Query: 64 DQILTLSTF*QLG*KKQSLCLTQISXHN 147 | ||||
Loading...

Blast Hits to Contig V2 Oall
Analysis Date: 11-17-2009 (Blast: CCall_contigs_v2_vs_Oall_contigs_v2)
Best 10 Hits Shown
Note: Click a description for more details.
Best 10 Hits Shown
Note: Click a description for more details.
| Match Name | E value | Identity | ||
|---|---|---|---|---|
Oall_contig17079_v2 | 2.73891e-17 | 71.88% | ||
Oall_contig17079_v2 | ||||
HSP 1 Score: 63.3837 bits (132), Expect = 2.73891e-17 Query: 50 RRLQKL*XLICVRQRLCFFYPNC*NVDNVKIW 145 HSP 2 Score: 32.6837 bits (65), Expect = 2.73891e-17 Query: 4 K*SKITNM*KFNNLVKKASEI 66 HSP 3 Score: 56.5106 bits (117), Expect = 2.42647e-16 Query: 66 TKS*HCQHFNN*DRRSKAFVLHK*VFT 146 HSP 4 Score: 36.3494 bits (73), Expect = 2.42647e-16 Query: 6 ISEAFLTRLLNFYIFVILLY 65 HSP 5 Score: 56.5106 bits (117), Expect = 1.38763e-14 Query: 62 PNLNIVNILTIRIEEAKPLSYTNKXSQF 145 HSP 6 Score: 30.3927 bits (60), Expect = 1.38763e-14 Query: 7 NF*SLLN*IVKLLHICYFTL 66 HSP 7 Score: 52.3867 bits (108), Expect = 8.95945e-14 Query: 60 RNCEXLFV*DKGFASSILIVKMLTMLRFG 146 HSP 8 Score: 31.7673 bits (63), Expect = 8.95945e-14 Query: 17 *QICKSLTI*LRRLQK 64 HSP 9 Score: 55.5941 bits (115), Expect = 9.41673e-12 Query: 67 DQILTLSTF*QLG*KKQSLCLTQISXH 147 HSP 10 Score: 21.6867 bits (41), Expect = 9.41673e-12 Query: 38 FLKPS*LDC 64 | ||||
Loading...

Blast Hits to Contig V2 RO454
Analysis Date: 11-17-2009 (Blast: CCall_contigs_v2_vs_RO454_contigs_v2)
Best 10 Hits Shown
Note: Click a description for more details.
Best 10 Hits Shown
Note: Click a description for more details.
| Match Name | E value | Identity | ||
|---|---|---|---|---|
RO454_contig11576_v2 | 1.96634e-17 | 71.88% | ||
RO454_contig11576_v2 | ||||
HSP 1 Score: 63.3837 bits (132), Expect = 1.96634e-17 Query: 50 RRLQKL*XLICVRQRLCFFYPNC*NVDNVKIW 145 HSP 2 Score: 32.6837 bits (65), Expect = 1.96634e-17 Query: 4 K*SKITNM*KFNNLVKKASEI 66 HSP 3 Score: 56.5106 bits (117), Expect = 1.74176e-16 Query: 66 TKS*HCQHFNN*DRRSKAFVLHK*VFT 146 HSP 4 Score: 36.3494 bits (73), Expect = 1.74176e-16 Query: 6 ISEAFLTRLLNFYIFVILLY 65 HSP 5 Score: 56.5106 bits (117), Expect = 9.95737e-15 Query: 62 PNLNIVNILTIRIEEAKPLSYTNKXSQF 145 HSP 6 Score: 30.3927 bits (60), Expect = 9.95737e-15 Query: 7 NF*SLLN*IVKLLHICYFTL 66 HSP 7 Score: 52.3867 bits (108), Expect = 6.42803e-14 Query: 60 RNCEXLFV*DKGFASSILIVKMLTMLRFG 146 HSP 8 Score: 31.7673 bits (63), Expect = 6.42803e-14 Query: 17 *QICKSLTI*LRRLQK 64 HSP 9 Score: 55.5941 bits (115), Expect = 6.75277e-12 Query: 67 DQILTLSTF*QLG*KKQSLCLTQISXH 147 HSP 10 Score: 21.6867 bits (41), Expect = 6.75277e-12 Query: 38 FLKPS*LDC 64 | ||||